circad | circRNAs associated with diseases

hsa_circ_0092306
Gene	CCS	Organism	Human
Genome Locus	chr11:66367407-66367747:+	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	31689616
Experimental Method
Sample Type	Tissues	Comparison	Six samples, including 3 GC tissues and 3 adjacent normal gastric mucosal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTAAACAACAGTTATATCA Reverse GAAACCCCATCTCTACTAACAAT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Chen, Z, Ju, H, Zhao, T, Yu, S, Li, P, Jia, J, Li, N, Jing, X, Tan, B, Li, Y (2019). hsa_circ_0092306 Targeting miR-197-3p Promotes Gastric Cancer Development by Regulating PRKCB in MKN-45 Cells. Mol Ther Nucleic Acids, 18:617-626.